SeqAn3  3.0.3
The Modern C++ library for sequence analysis.
seqan3::dot_bracket3 Class Reference

The three letter RNA structure alphabet of the characters ".()". More...

#include <seqan3/alphabet/structure/dot_bracket3.hpp>

+ Inheritance diagram for seqan3::dot_bracket3:

Public Member Functions

Constructors, destructor and assignment
constexpr dot_bracket3 () noexcept=default
 Defaulted.
 
constexpr dot_bracket3 (dot_bracket3 const &) noexcept=default
 Defaulted.
 
constexpr dot_bracket3 (dot_bracket3 &&) noexcept=default
 Defaulted.
 
constexpr dot_bracket3operator= (dot_bracket3 const &) noexcept=default
 Defaulted.
 
constexpr dot_bracket3operator= (dot_bracket3 &&) noexcept=default
 Defaulted.
 
 ~dot_bracket3 () noexcept=default
 
Read functions
constexpr char_type to_char () const noexcept
 Return the letter as a character of char_type. More...
 
constexpr rank_type to_rank () const noexcept
 Return the letter's numeric value (rank in the alphabet). More...
 
Write functions
constexpr dot_bracket3assign_char (char_type const c) noexcept
 Assign from a character, implicitly converts invalid characters. More...
 
constexpr dot_bracket3assign_rank (rank_type const c) noexcept
 Assign from a numeric value. More...
 

Static Public Attributes

static constexpr detail::min_viable_uint_t< size > alphabet_size
 The size of the alphabet, i.e. the number of different values it can take. More...
 

Protected Types

Member types
using char_type = std::conditional_t< std::same_as< char, void >, char, char >
 The char representation; conditional needed to make semi alphabet definitions legal. More...
 
using rank_type = detail::min_viable_uint_t< size - 1 >
 The type of the alphabet when represented as a number (e.g. via to_rank()). More...
 

Private Types

using base_t = alphabet_base< dot_bracket3, 3 >
 The base class.
 

Private Attributes

friend base_t
 Befriend seqan3::alphabet_base.
 
rank_type rank
 The value of the alphabet letter is stored as the rank.
 

Static Private Attributes

static constexpr std::array< rank_type, 256 > char_to_rank
 Char-to-value conversion table. More...
 
static constexpr char_type rank_to_char [alphabet_size]
 Value-to-char conversion table. More...
 

Related Functions

(Note that these are not member functions.)

Literals
std::vector< dot_bracket3operator""_db3 (const char *str, std::size_t len)
 The seqan3::db3 string literal. More...
 
constexpr dot_bracket3 operator""_db3 (char const ch) noexcept
 The seqan3::db3 char literal. More...
 
Generic serialisation functions for all seqan3::semialphabet

All types that satisfy seqan3::semialphabet can be serialised via Cereal.

template<cereal_output_archive archive_t, semialphabet alphabet_t>
alphabet_rank_t< alphabet_t > save_minimal (archive_t const &, alphabet_t const &l)
 Save an alphabet letter to stream. More...
 

RNA structure properties

static constexpr uint8_t max_pseudoknot_depth {1u}
 The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth. More...
 
constexpr bool is_pair_open () const noexcept
 Check whether the character represents a rightward interaction in an RNA structure. More...
 
constexpr bool is_pair_close () const noexcept
 Check whether the character represents a leftward interaction in an RNA structure. More...
 
constexpr bool is_unpaired () const noexcept
 Check whether the character represents an unpaired position in an RNA structure. More...
 
constexpr std::optional< uint8_t > pseudoknot_id () const noexcept
 Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id. More...
 

Detailed Description

The three letter RNA structure alphabet of the characters ".()".

The brackets denote RNA base pair interactions. Every left bracket must have a corresponding right bracket. Pseudoknots cannot be expressed in this format. A dot (.) represents a character that is not paired.

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))).

Usage

The following code example creates a dot_bracket3 vector, modifies it, and prints the result to stderr.

#include <vector>
int main()
{
using seqan3::operator""_db3;
// create vector
std::vector<seqan3::dot_bracket3> vec{'.'_db3, ')'_db3, ')'_db3};
// modify and print
vec[1] = '('_db3;
for (seqan3::dot_bracket3 chr : vec)
}
The three letter RNA structure alphabet of the characters ".()".
Definition: dot_bracket3.hpp:52
Provides seqan3::debug_stream and related types.
Provides the dot bracket format for RNA structure.
constexpr auto to_char
Return the char representation of an alphabet object.
Definition: concept.hpp:328
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition: debug_stream.hpp:42

Member Typedef Documentation

◆ char_type

using seqan3::alphabet_base< dot_bracket3 , size, char >::char_type = std::conditional_t<std::same_as<char , void>, char, char >
protectedinherited

The char representation; conditional needed to make semi alphabet definitions legal.

We need a return type for seqan3::alphabet_base::to_char and seqan3::alphabet_base::assign_char other than void to make these in-class definitions valid when char_t is void.

This entity is stable. Since version 3.1.

◆ rank_type

using seqan3::alphabet_base< dot_bracket3 , size, char >::rank_type = detail::min_viable_uint_t<size - 1>
protectedinherited

The type of the alphabet when represented as a number (e.g. via to_rank()).

This entity is stable. Since version 3.1.

Constructor & Destructor Documentation

◆ ~dot_bracket3()

seqan3::dot_bracket3::~dot_bracket3 ( )
defaultnoexcept

Defaulted.

Member Function Documentation

◆ assign_char()

constexpr dot_bracket3 & seqan3::alphabet_base< dot_bracket3 , size, char >::assign_char ( char_type const  c)
inlineconstexprnoexceptinherited

Assign from a character, implicitly converts invalid characters.

Parameters
cThe character to be assigned.

Provides an implementation for seqan3::assign_char_to, required to model seqan3::alphabet.

Complexity

Constant.

Exceptions

Guaranteed not to throw.

This entity is stable. Since version 3.1.

◆ assign_rank()

constexpr dot_bracket3 & seqan3::alphabet_base< dot_bracket3 , size, char >::assign_rank ( rank_type const  c)
inlineconstexprnoexceptinherited

Assign from a numeric value.

Parameters
cThe rank to be assigned.

Provides an implementation for seqan3::assign_rank_to, required to model seqan3::semialphabet.

Complexity

Constant.

Exceptions

Guaranteed not to throw.

This entity is stable. Since version 3.1.

◆ is_pair_close()

constexpr bool seqan3::dot_bracket3::is_pair_close ( ) const
inlineconstexprnoexcept

Check whether the character represents a leftward interaction in an RNA structure.

Returns
True if the letter represents a leftward interaction, False otherwise.

◆ is_pair_open()

constexpr bool seqan3::dot_bracket3::is_pair_open ( ) const
inlineconstexprnoexcept

Check whether the character represents a rightward interaction in an RNA structure.

Returns
True if the letter represents a rightward interaction, False otherwise.

◆ is_unpaired()

constexpr bool seqan3::dot_bracket3::is_unpaired ( ) const
inlineconstexprnoexcept

Check whether the character represents an unpaired position in an RNA structure.

Returns
True if the letter represents an unpaired site, False otherwise.

◆ pseudoknot_id()

constexpr std::optional<uint8_t> seqan3::dot_bracket3::pseudoknot_id ( ) const
inlineconstexprnoexcept

Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id.

Returns
The pseudoknot id (always 0) if alph denotes an interaction, and no value otherwise.

◆ to_char()

constexpr char_type seqan3::alphabet_base< dot_bracket3 , size, char >::to_char ( ) const
inlineconstexprnoexceptinherited

Return the letter as a character of char_type.

Provides an implementation for seqan3::to_char, required to model seqan3::alphabet.

Complexity

Constant.

Exceptions

Guaranteed not to throw.

This entity is stable. Since version 3.1.

◆ to_rank()

constexpr rank_type seqan3::alphabet_base< dot_bracket3 , size, char >::to_rank ( ) const
inlineconstexprnoexceptinherited

Return the letter's numeric value (rank in the alphabet).

Provides an implementation for seqan3::to_rank, required to model seqan3::semialphabet.

Complexity

Constant.

Exceptions

Guaranteed not to throw.

This entity is stable. Since version 3.1.

Friends And Related Function Documentation

◆ operator""_db3() [1/2]

constexpr dot_bracket3 operator""_db3 ( char const  ch)
related

The seqan3::db3 char literal.

Parameters
[in]chThe character to represent as dot bracket.
Returns
seqan3::dot_bracket3

You can use this string literal to assign a seqan3::dot_bracket3 character:

int main()
{
using seqan3::operator""_db3;
// Using the char literal to assign a single dot bracket:
seqan3::dot_bracket3 my_letter{'('_db3};
my_letter.assign_char(')'); // <- assigns the char explicitly
}
constexpr derived_type & assign_char(char_type const c) noexcept
Assign from a character, implicitly converts invalid characters.
Definition: alphabet_base.hpp:158

◆ operator""_db3() [2/2]

std::vector< dot_bracket3 > operator""_db3 ( const char *  str,
std::size_t  len 
)
related

The seqan3::db3 string literal.

Parameters
[in]strA pointer to the character string to assign.
[in]lenThe size of the character string to assign.
Returns
std::vector<seqan3::dot_bracket3>

You can use this string literal to easily assign to a vector of seqan3::dot_bracket3 characters:

#include <vector>
int main()
{
using seqan3::operator""_db3;
// Using the string literal to assign a vector of dot brackets:
auto bax = ".(..)."_db3;
}

◆ save_minimal()

template<cereal_output_archive archive_t, semialphabet alphabet_t>
alphabet_rank_t< alphabet_t > save_minimal ( archive_t const &  ,
alphabet_t const &  l 
)
related

Save an alphabet letter to stream.

Template Parameters
archive_tMust satisfy seqan3::cereal_output_archive.
alphabet_tType of l; must satisfy seqan3::semialphabet.
Parameters
lThe alphabet letter.

Delegates to seqan3::to_rank.

Attention
These functions are never called directly, see the Alphabet module on how to use serialisation.

This entity is stable. Since version 3.1.

Member Data Documentation

◆ alphabet_size

constexpr detail::min_viable_uint_t<size> seqan3::alphabet_base< dot_bracket3 , size, char >::alphabet_size
staticconstexprinherited

The size of the alphabet, i.e. the number of different values it can take.

This entity is stable. Since version 3.1.

◆ char_to_rank

constexpr std::array<rank_type, 256> seqan3::dot_bracket3::char_to_rank
staticconstexprprivate
Initial value:
{
[] () constexpr
{
for (rank_type & rnk : rank_table)
rnk = 0u;
rank_table['.'] = 0u;
rank_table['('] = 1u;
rank_table[')'] = 2u;
return rank_table;
} ()
}
detail::min_viable_uint_t< size - 1 > rank_type
The type of the alphabet when represented as a number (e.g. via to_rank()).
Definition: alphabet_base.hpp:74

Char-to-value conversion table.

◆ max_pseudoknot_depth

constexpr uint8_t seqan3::dot_bracket3::max_pseudoknot_depth {1u}
staticconstexpr

The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth.

It is the number of distinct pairs of interaction symbols the format supports. The value 1 denotes no pseudoknot support.

◆ rank_to_char

constexpr char_type seqan3::dot_bracket3::rank_to_char[alphabet_size]
staticconstexprprivate
Initial value:
{
'.',
'(',
')'
}

Value-to-char conversion table.


The documentation for this class was generated from the following file: